[NTG-context] Converting XHTML captions to ConTeXt captions

xtablebody[body] \startxrow \startxcell \xmlflush{#1} \stopxcell \stopxrow \stopxtablebody \stopembeddedxtable \stopplacetable \blank \stopxmlsetups \xmlregistersetup{xml:demo} \starttext \xmlprocessbuffer{demo}{demo}{} \stop

Re: [NTG-context] xtable - what might prevent splitting?

a second page. \setupxtable[width=4cm,option={stretch,width}] \setupxtable[split=yes] \starttext \placetable[here]{} \startxtable \startxrow \startxcell cell one \stopxcell \startxcell cell two \stopxcell \startxcell cell three\stopxcell \stopxrow ... and so on and so forth for twenty or so

[NTG-context] xtable - what might prevent splitting?

}] \setupxtable[split=yes] \starttext \placetable[here]{} \startxtable \startxrow \startxcell cell one \stopxcell \startxcell cell two \stopxcell \startxcell cell three\stopxcell \stopxrow ... and so on and so forth for twenty or so rows, but certainly enough to require a second page

Re: [NTG-context] The same Table, im Math Modus?

Math Modus? Ursula Hermann via ntg-context mailto:ntg-context@ntg.nl>> 于2023年3月21日周二 20:45写道： I’d like to do a Table lik this one [enter image description here] I have no example. How can I do that? You can use xtable, e.g. \startxtable[frame=off,width=1cm,align=center] \startxrow[botto

Re: [NTG-context] The same Table, im Math Modus?

Ursula Hermann via ntg-context 于2023年3月21日周二 20:45写道： > > > I’d like to do a Table lik this one > > [image: enter image description here] > > I have no example. How can I do that? > > > You can use xtable, e.g. \startxtable[frame=off,width=1cm,align=center] \startx

Re: [NTG-context] Disappearing footnote in figure / tabulate

\eTR \bTR \bTD One \eTD \bTD two \eTD \eTR \eTABLE \stopplacetable % \startpostponingnotes \startplacetable \startxtable \startxrow \startxcell a\footnote{5}\stopxcell \startxcell b\footnote{6}\stopxcell \stopxrow \stopxtable \stopplacetable % \stoppostponingnotes \stoptext

[NTG-context] Disappearing footnote in figure / tabulate

\NC\NR \stoptabulate \stopplacetable \startplacetable \bTABLE \bTR \bTD One\footnote{4} \eTD \bTD two \eTD \eTR \bTR \bTD One \eTD \bTD two \eTD \eTR \eTABLE \stopplacetable % \startpostponingnotes \startplacetable \startxtable \startxrow \startxcell a\footnote{5}\stopxcell \startxcell b\footnote

Re: [NTG-context] xtables regression with LMTX 2022-12-21

On 12/22/2022 9:14 PM, Rik Kabel via ntg-context wrote: With the latest (2022-12-21) LMTX I see a regression in xtables. The following code: \starttext \startxtable   \startxrow     \startxcell   This is a line of text.     \stopxcell     \startxcell

[NTG-context] xtables regression with LMTX 2022-12-21

With the latest (2022-12-21) LMTX I see a regression in xtables. The following code: \starttext \startxtable   \startxrow     \startxcell   This is a line of text.     \stopxcell     \startxcell   \contextversion     \stopxcell   \stopxrow

Re: [NTG-context] filling buffers in cld documents

txcell {"width=1.5cm","align=flushright"} context(Eleve[note]) context("/") context(notemax)   context.stopxcell ()    end    \stopluacode    \startbuffer [grille]    \startxtable   \startxrow \startxcell     \ct

[NTG-context] filling buffers in cld documents

context(Eleve[note]) context("/") context(notemax) context.stopxcell () end \stopluacode \startbuffer [grille] \startxtable \startxrow \startxcell \ctxlua {userdata.Critere ("structure","NoteStructure"

Re: [NTG-context] How to make a row of text have vertical centering in tabulate environment?

lly so the text is vertically centered just in > specific rows? Hi Joel, I have no experience with tabulates, but I wouldn’t be surprised if they didn’t support vertical alignment. You can achieve that with xtables: \starttext \startxtable[frame=off, option={stretch, width}] \startxrow[topfra

Re: [NTG-context] How to make a row of text have vertical centering in tabulate environment?

one marked row. By default, they seem to place each cell aligned to the top, but how can I adjust them vertically so the text is vertically centered just in specific rows? Use natural or extreme tables. \starttext \startxtable[frame=off,topframe=on,bottomframe=on] \startx

Re: [NTG-context] Auto width and height on table cells

starttext \showframe \startbuffer row\currentxtablerow--col\currentxtablecolumn \stopbuffer \startbuffer[table] \startxtable[option={stretch, height}, align={lohi, middle}] \startxrow \dorecurse{5} {\startxcell[width=.115\textwidth]\inlinebuffer\

Re: [NTG-context] Auto width and height on table cells

wframe \startbuffer row\currentxtablerow--col\currentxtablecolumn \stopbuffer \startbuffer[table] \startxtable[option={stretch, height}, align={lohi, middle}] \startxrow \startxcell[width=3cm, option=fixed]\inlinebuffer\stopxcell \dorecurse{5} {\star

Re: [NTG-context] Auto width and height on table cells

=blue] \setupxtable[bold] [crap][foregroundstyle=bold] \startxtable[frame=off] \startxtablehead \startxrow[bold] \startxcell[suffix] a 0 \stopxcell \startxcell[blabla] a 1 \stopxcell \startxcell a 2 \stopxcell \stopxrow

Re: [NTG-context] Auto width and height on table cells

Am 30.06.22 um 08:40 schrieb Angel M Alganza via ntg-context: Hello, Hans, On Thu, Jun 30, 2022 at 08:16:53AM +0200, Hans Hagen via ntg-context wrote: \startxtable[option=stretch]   \startxrow   \startxcell[width=3cm,option=fixed] one \stopxcell Thank you very much, that does part

Re: [NTG-context] Auto width and height on table cells

Hello, Hans, On Thu, Jun 30, 2022 at 08:16:53AM +0200, Hans Hagen via ntg-context wrote: \startxtable[option=stretch] \startxrow \startxcell[width=3cm,option=fixed] one \stopxcell Thank you very much, that does part of the trick (the column width). Is there a way to do the same

Re: [NTG-context] Auto width and height on table cells

t possible to have ConTeXt do all those calculations for me? I haven't been able to figure it out from the manuals and the wiki. \starttext \startxtable[option=stretch] \startxrow \startxcell[width=3cm,option=fixed] one \stopxcell \startxcell two \stopxcell \startxcell three

Re: [NTG-context] \startXML vs \startPARSEDXML

ppapersize[A4, landscape] > \setupbodyfont[dejavu] > \starttext > \startxtable[option=stretch] > \startxrow[offset=1ex] > \startxcell > \startXML > > > > > Anuncio > > Belleza > > > > \stopXM

Re: [NTG-context] \startXML vs \startPARSEDXML

\startPARSEDXML. How do they > differ? Hi Denis, yesterday I had to start using xml instead of parsed-xml. See the difference: \setuppapersize[A4, landscape] \setupbodyfont[dejavu] \starttext \startxtable[option=stretch] \startxrow[offset=1ex] \startxcell \startXML

Re: [NTG-context] fixing indentation of xtable inside item

; \starttext > \startitemize > \item > Determine la {\sc an} de cada objetivo del microscopio, con los ángulos > de la tabla y teniendo en cuenta lo siguiente: $n_{\text{aire}} = 1$ y > $n_{\text{aceite de inmersión}} = 1.515$: > \blank > \startxtable[align=middle,option=stretch]

[NTG-context] fixing indentation of xtable inside item

}} = 1$ y $n_{\text{aceite de inmersión}} = 1.515$: \blank \startxtable[align=middle,option=stretch] \startxtablebody[body] \startxrow \startxcell Objetivo 4x \stopxcell \startxcell $n=1$ \stopxcell \startxcell $\alpha=5.8$ \stopxcell \startxcell {\sc an}$=$ \stopxcell \stopxrow

Re: [NTG-context] Every odd row with a background color with extreme tables?

> fill OverlayBox withcolor "gray"; > \stopuseMPgraphic > > \defineoverlay >[xtablerow] >[\ifodd\currentxtablerow > \useMPgraphic{xtablerow}% > \fi] > > \starttext > >

Re: [NTG-context] Every odd row with a background color with extreme tables?

[\ifodd\currentxtablerow \useMPgraphic{xtablerow}% \fi] \starttext \startxtable[frame=off,background=xtablerow] \dorecurse{20} {\startxrow \startxcell Column 1 \stopxcell \startxcell Column 2 \stopxcell \stopxrow} \stopxtable \stoptext

Re: [NTG-context] xtable as list item (again)

On 6/16/21 9:56 PM, Wolfgang Schuster wrote: > Pablo Rodriguez schrieb am 15.06.2021 um 19:57: >>[...] >>\showframe\showstruts >>\starttext >>\startitemize[n][margin=yes] >>\item a >>\item >> \startembeddedxtable[option={stret

Re: [NTG-context] xtable as list item (again)

] \item a \item \startembeddedxtable[option={stretch, width}] \dorecurse{25}{\startxrow \startxcell \Characters{\recurselevel}\stopxcell \startxcell \characters{\recurselevel}\stopxcell \stopxrow} \stopembeddedxtable \item \startfixed % put your table

[NTG-context] xtable as list item (again)

={stretch, width}] \dorecurse{25}{\startxrow \startxcell \Characters{\recurselevel}\stopxcell \startxcell \characters{\recurselevel}\stopxcell \stopxrow} \stopembeddedxtable \item b \stopitemize \stoptext And I get two issues: 1. Item number in 2 is placed on the bottom

Re: [NTG-context] Side-by-side environment

twidth,strut=no,offset=1ex,framecolor=black,rulethickness=0.5pt]   \startxrow [corner=03,align=normal]     \startxcell       \typebuffer [userdata] [option=tex]     \stopxcell   \stopxrow   \startxrow [corner=01,align=normal]     \startxcell       \getuserdata     \stopxcell

[NTG-context] Side-by-side environment

] [renderingsetup=userdata:example] \startsetups [userdata:example] \blank \startembeddedxtable [width=\textwidth,strut=no,offset=1ex,framecolor=black,rulethickness=0.5pt] \startxrow [corner=03,align=normal] \startxcell \typebuffer [userdata] [option=tex] \stopxcell

Re: [NTG-context] xtable in def or setups

Hi Adam, no, I hadn't tried that - even tough I had skimmed over that part way back, it now escaped me. \long\def\iconblock[#1]#2{% \ignorespaces *\startembeddedxtable[icbtable]* \startxrow \startxcell[width=17mm] \externalfigure[img/#1.svg][height=15mm,width=15mm

Re: [NTG-context] xtable in def or setups

a \setups) > but always run into "runaway error: end of file encountered" > whenever the xtable-commands are in there. > > \definextable[icbtable] > \setupxtable[icbtable] > [frame=off, > top=\vskip7mm] > \long\def\iconblock[#1]#2{% > \ignorespaces > \startxtabl

[NTG-context] xtable in def or setups

\long\def\iconblock[#1]#2{% \ignorespaces \startxtable[icbtable] \startxrow \startxcell[width=17mm] \externalfigure[img/#1.svg][height=15mm,width=15mm] \stopxcell \startxcell #2 \stopxcell \stopxrow \stopxtable \removeunwantedspaces } Is this simply not possible or

[NTG-context] new page before xtable with repeated headers

header] \setupxtable[mytable:header] [ foregroundstyle=\bf, foregroundcolor=darkred, ] % == \startdocument \dorecurse{2} { \input tufte \vskip7mm } \startxtable[mytable] \startxtablehead \startxrow[mytable:header] \startxcell Some Header \stopxcell \st

[NTG-context] 3 questions about xtables after reading manuals

arrowed so much as to break a line of 4 or 5 words. MWE: % \startplacetable[location=none] %\startxtable[align={middle,lohi},option=tight] % This makes the first column too narrow. Lines are not that long \startxtable[align={middle,lohi}] \startxtablehead[head] \startxrow \startx

[NTG-context] Hatch a cell : meta:hash:left

,middle}, width=1.5cm,framecolor=purple] \startxrow \startxcell[background=color,backgroundcolor=paleturquoise] i \stopxcell \startxcell [background=meta:hash:left, meta:hash:linecolor=green] \stopxcell \startxcell 0 \stopxcell \startxcell 1 \stopxcell \startxcell 2 \stopxcell \stopxrow

[NTG-context] xtable as list item

Dear list, I have the following sample: \starttext \startitemize[n][margin=yes] \item a \item \startembeddedxtable[option={stretch, width}] \dorecurse{25}{\startxrow \startxcell \Characters{\recurselevel}\stopxcell \startxcell \characters{\recurselevel}\stopxcell

Re: [NTG-context] How can I make the notes under this table inherit the width of the table, and not the \textwidth?

all]\emph{Fuente:}~#1\par\stop} > > \starttext > \reference[tbl:t03]{}% > \startplacetable[title={Composición química y valor energético de recursos > forrajeros de corte en el área de influencia del Subproyecto Carne Bovina > (trópico de altura).}] > \startxtable[option=tight,bodyfo

[NTG-context] How can I make the notes under this table inherit the width of the table, and not the \textwidth?

\par\stop} \starttext \reference[tbl:t03]{}% \startplacetable[title={Composición química y valor energético de recursos forrajeros de corte en el área de influencia del Subproyecto Carne Bovina (trópico de altura).}] \startxtable[option=tight,bodyfont=7pt] \startxtablehead[head] \startxrow

Re: [NTG-context] page ends with a section title followed by a table

gt; because the optional argument is for userdata (values like author etc.) > > > \startxtable > > \startxrow > > \startxcell[ny=30]a\stopxcell\startxcell 1\stopxcell > > \stopxrow > > \dorecurse{29}{\startxrow\startxcell 2\stopxcell\s

Re: [NTG-context] page ends with a section title followed by a table

,big]}, after={\blank[samepage,big]}] Your settings in the second argument of \startsection make no sense because the optional argument is for userdata (values like author etc.)     \startxtable     \startxrow     \startxcell[ny=30]a\stopxcell\startxcell 1\stopxcell     \stopxrow

Re: [NTG-context] page ends with a section title followed by a table

testpage[4]\blank[2*big]}] > > Wolfgang > Hi Wolfgang, Thanks for the suggestion, but as illustrated by the second example, copied here, where the section title is at the top of the page: \starttext \showframe \dorecurse{50}{a } \startsection[title=spec][before={\blank[preferenc

Re: [NTG-context] page ends with a section title followed by a table

My mistake, but the problem survives the fix: \setuphead[section][after={\blank[samepage,big]}] \starttext \showframe \dorecurse{50}{a } \startsection[title=spec] \startxtable \startxrow \startxcell[ny=30]a\stopxcell\startxcell 1\stopxcell \stopxrow

Re: [NTG-context] page ends with a section title followed by a table

\starttext \showframe \dorecurse{50}{a } \startsection[title=spec][before={\blank[preference,big]}, after={\blank[samepage,big]}] \startxtable \startxrow \startxcell[ny=30]a\stopxcell\startxcell 1\stopxcell \stopxrow \dorecurse{29}{\startxrow\startxcell 2\stopxcell\

[NTG-context] page ends with a section title followed by a table

c } \section{title} \startxtable \startxrow \startxcell[ny=10]a\stopxcell\startxcell 1\stopxcell \stopxrow \dorecurse{9}{\startxrow\startxcell 2\stopxcell\stopxrow} \stopxtable \stoptext Does anyone know where to adjust the penalty in this case, so that the section

[NTG-context] extra warning in the lua version

xtable() context.startxrow() context.startxcell() context.starttyping() context('1') context.stoptyping() context.stopxcell() context.stopxrow() context.stopxtable() \stopluacode % this does not \startxtable \startxrow \startxcell \starttyping

Re: [NTG-context] \define in conflict with \startxtable[]

Sylvain Hubert schrieb am 08.11.2020 um 04:54: Dear List, Could anyone manage to typeset the following example? Here [] causes an error "Extra }, or forgotten \endgroup".     \starttext     \define\sample{     \startxtable[]     \startxtablehead     \startxrow     \star

[NTG-context] \define in conflict with \startxtable[]

Dear List, Could anyone manage to typeset the following example? Here [] causes an error "Extra }, or forgotten \endgroup". \starttext \define\sample{ \startxtable[] \startxtablehead \startxrow \startxcell 123\stopxcell \stopxrow \stopxtablehead \

Re: [NTG-context] xtable row number trouble

] \starttext \startxtable \startxrow \startxcell \incrementcounter[rownum] \rawcounter[rownum] \stopxcell \stopxrow \startxrow \startxcell \incrementcounter[rownum] \rawcounter[rownum

Re: [NTG-context] xtable row number trouble

xt,prefix=no] > > \setcounter[rownum][0] > > > > \starttext > > \startxtable > > \startxrow > > \startxcell > > \incrementcounter[rownum] > > \rawcounter[rownum] > > \stopxcell > >

Re: [NTG-context] xtable row number trouble

Oleg schrieb am 25.10.2020 um 14:51: Hi, all. I try to place a row number into the first column of my table. I tried: \definecounter[rownum][way=bytext,prefix=no] \setcounter[rownum][0] \starttext \startxtable \startxrow \startxcell \incrementcounter[rownum

[NTG-context] xtable row number trouble

Hi, all. I try to place a row number into the first column of my table. I tried: \definecounter[rownum][way=bytext,prefix=no] \setcounter[rownum][0] \starttext \startxtable \startxrow \startxcell \incrementcounter[rownum] \rawcounter[rownum

[NTG-context] \dorecurse{}{} problem

o use extreme tables for this: > > = > \starttext > > \dorecurse{3}{\input knuth} > > \startxtable[split=yes,frame=off] > \startxrow > \startxcell Text \stopxcell > \startxcell Übersetzung \stopxcell > \stopxrow > \startxrow > \startxcell \

Re: [NTG-context] Extreme tables and XML conflict?

On 9/21/2020 4:38 PM, Denis Maier wrote: Hi, I'm a bit confused, but this here won't compile: \startxmlsetups xml:table   \startxtable     \startxrow   \startxcell one \stopxcell   \startxcell two \stopxcell     \stopxrow   \stopxtable \stopxmlsetups when used this way you

[NTG-context] How to get the last item from an XML node

\stopxmlsetups \startxmlsetups xml:table:tbody     \xmlfilter{#1}{/tr/last()/command(xml:table:tbody:tr)} \stopxmlsetups \startxmlsetups xml:table:tbody:tr     \startxrow     \xmlfilter{#1}{/td/command(xml:table:tbody:tr:td)}     \stopxrow \stopxmlsetups \startxmlsetups xml:table:tbody:tr:td

Re: [NTG-context] Extreme tables and XML conflict?

Am 21.09.2020 um 16:50 schrieb Wolfgang Schuster: Denis Maier schrieb am 21.09.2020 um 16:38: Hi, I'm a bit confused, but this here won't compile: [...] \startxmlsetups xml:table     \startembeddedxtable     \startxrow     ...     \stopxrow     \stopembeddedxtable

Re: [NTG-context] Extreme tables and XML conflict?

!='parallel']}{xml:table}     \stopxmlsetups \xmlregistersetup{xml:test} \startxmlsetups xml:article \starttext     \xmlflush{#1} \stoptext \stopxmlsetups \startxmlsetups xml:table   \startxtable     \startxrow   \startxcell one \stopxcell   \startxcell two \stopxcell     \stopxrow   \stopxtable

Re: [NTG-context] Extreme tables and XML conflict?

> On 21 Sep 2020, at 16:38, Denis Maier wrote: > > Hi, > > I'm a bit confused, but this here won't compile: > > = > > \startxmlsetups xml:table > \startxtable > \startxrow > \startxcell one \stopxcell > \st

Re: [NTG-context] \dorecurse{}{} problem

Hi Dalyoung, I don't know why \recurselevel returns 0 inside a tabulate environment, but the following works fine: \starttext \startxtable[frame=off,bottomframe=on,width=1cm,align={middle,lohi}] \startxrow\startxcell \stopxcell\stopxrow % just to have a line on the top of the first row

Re: [NTG-context] \dorecurse{}{} problem

d > > Hi, > > I'm trying to typeset a parallel text that should appear in columns. The > sources are XML, and there I have to use tables for this. So, I thought > the easiest way is to use extreme tables for this: > > = > \starttext > &

[NTG-context] Extreme tables and XML conflict?

\xmlregistersetup{xml:test} \startxmlsetups xml:article \starttext     \xmlflush{#1} \stoptext \stopxmlsetups \startxmlsetups xml:table   \startxtable     \startxrow   \startxcell one \stopxcell   \startxcell two \stopxcell     \stopxrow   \stopxtable \stopxmlsetups \xmlprocessbuffer{test}{test

[NTG-context] Parallel text support

,frame=off] \startxrow \startxcell Text \stopxcell \startxcell Übersetzung \stopxcell \stopxrow \startxrow \startxcell \input ward \stopxcell \startxcell \input tufte \stopxcell \stopxrow \stopxtable \stoptext = However, as it turns out, split only seems to mean that the table

Re: [NTG-context] weird issue with xtable

eing typeset in a horizontal context, > based on the error message (at least, if we assume that the error > message was triggered by a table). I think it is easy to trigger the error: \setupxtable[split=yes] \starttext \ifvmode yes\else no\fi \startxtable[align={middle,

[NTG-context] Bug with lmtx and color in table

Hello, With the latest version of lmtx, the background color of cells does not work. Thank you. Fabrice \starttext \startxtable [align={middle,lohi}, offset=0.8ex,background=color, backgroundcolor=red,frame=off] \startxrow \startxcell \m{\displaystyle

Re: [NTG-context] Incorrect placement of a table with LMTX

old, >width=broad] > > \defineenumeration >[definition] >[text=Définition, > number=yes, > headcommand=\groupedcommand{}{.}, > style=italic] > > \starttext > > \startdefinition > \blank > \startxtable[align={lohi,middle},w

Re: [NTG-context] Incorrect placement of a table with LMTX

yes, > headcommand=\groupedcommand{}{.}, > style=italic] > > \starttext > > \startdefinition > \blank > \startxtable[align={lohi,middle},width=2cm,offset=0.8ex] > \startxrow > \startxcell > 1 > \stopxcell > \startxcell > 2

[NTG-context] Incorrect placement of a table with LMTX

={lohi,middle},width=2cm,offset=0.8ex] \startxrow \startxcell 1 \stopxcell \startxcell 2 \stopxcell \stopxrow \startxrow \startxcell 3 \stopxcell \startxcell 4 \stopxcell \stopxrow \stopxtable

Re: [NTG-context] Problem with \vfill in extreme table

. What's the 'official' way to align top and bottom in an xrow? MWE \setuppapersize [A4] [A4] \starttext \startxtable[width=\textwidth]    \startxrow[height=150mm] \startxcell[align=middle]    Top    \vfill    Bottom \stopxcell    \stopxrow \stopxtable \stoptext It's

Re: [NTG-context] Problem with \vfill in extreme table

in an xrow? MWE \setuppapersize [A4] [A4] \starttext \startxtable[width=\textwidth] \startxrow[height=150mm] \startxcell[align=middle] Top \vfill Bottom \stopxcell \stopxrow \stopxtable \stoptext It's not a real fix but you can you exclude the \vfi

[NTG-context] Problem with \vfill in extreme table

\starttext \startxtable[width=\textwidth] \startxrow[height=150mm] \startxcell[align=middle] Top \vfill Bottom \stopxcell \stopxrow \stopxtable \stoptext The error message is: > tex error > tex error on line 4 in file virtual://buffer.x_table_1

Re: [NTG-context] mkiv digits/units zero padding not working

={.}] \startxtablehead \startxrow[topframe=on, foregroundstyle=bold] \startxcell A \stopxcell \startxcell[align=left, nx=3] Bla bla bla bla bla bla bla bla \stopxcell \startxcell C \stopxcell \stopxrow \stopxtablehead

Re: [NTG-context] mkiv digits/units zero padding not working

ve a lot of typing, if I wouldn’t have >> to specify the padding manually and I vaguely recall that there is somewhere >> a ConTeXt solution that can make such alignments, but I simply can’t find it >> any more … > > You can align number on the decimal point (comma) but this works o

Re: [NTG-context] mkiv digits/units zero padding not working

on the decimal point (comma) but this works only when you have only one number in a cell. \starttext \startxtable[aligncharacter=yes,alignmentcharacter=±] \startxrow \startxcell \digits {14.0} ± \digits {1.5} \stopxcell \stopxrow \startxrow \startxcell

Re: [NTG-context] \placetable[location=split] reference ??

be different as soon as xtable tries to place them … Cheers \startplacetable[reference=tab1,title={A table},location=split] \startxtable[split=repeat] \startxrow \startxcell hi \stopxcell \stopxrow \stopxtable \stopplacetable > On 22 Apr 2020, at 21:10, Benjamin Buchmuller > wrote: > >

Re: [NTG-context] Hyphentation/Linebreak after x characters

edtext[width=6cm,style=mono] >> \sethyphenationfeatures[dna] >> \setuphyphenation[method=traditional] >> GATTGCTTACTCCTGGTTGG% >> TCTTACATTCTGTCGCCTC% >> CTACTAGAGCCGGCATATT% >> CTAG

Re: [NTG-context] Hyphentation/Linebreak after x characters

\define[1]\DNAspacer{#1\hskip 2.3pt plus .1pt} \define[2]\mycommandc{     \startxrow     \startxcell o#1 \stopxcell     \startxcell {\tt\WORD{\DNA{5'-#2}}}\stopxcell     \stopxrow     } \starttext \setupxtable[width=5cm] \startxtable \my

Re: [NTG-context] Hyphentation/Linebreak after x characters

no difference towards the result. This is the MWE based on your solution: \define[2]\mycommandc{ \startxrow \startxcell o#1 \stopxcell \startxcell \tt\WORD{5'-#2} \stopxcell \stopxrow } \definebreakpoint[mybreaks][][nright=100,nleft=100,type=1] \setbreakpoints[mybreaks] \starttext

Re: [NTG-context] Hyphentation/Linebreak after x characters inside \WORD?

On 4/23/2020 15:01, Benjamin Buchmuller wrote: Sorry, I have just realized that the problem might not be \WORD{} actually, so this one hyphenates: \define[2]\mycommand{ \startxrow \startxcell o#1 \stopxcell \startxcell \tt\WORD #2 \stopxcell \stopxrow

Re: [NTG-context] Hyphentation/Linebreak after x characters inside \WORD?

Sorry, I have just realized that the problem might not be \WORD{} actually, so this one hyphenates: \define[2]\mycommand{ \startxrow \startxcell o#1 \stopxcell \startxcell \tt\WORD #2 \stopxcell \stopxrow } Whereas these ones don’t: \define[2

[NTG-context] Hyphentation/Linebreak after x characters inside \WORD?

using: \defineseparatedlist [mylist] [ separator={,}, quotechar={"}, command=\mycommand ] \define[2]\mycommand{ \startxrow \startxcell o#1 \stopxcell \startxcell 5’-{\tt\WORD{#2}}-3' \stopxcell \stopxrow } Since I

[NTG-context] \placetable[location=split] reference ??

Hi, I would like to reference a table of the following structure. \starttext \startplacetable[reference=tab1,title={A table},location=split] \startxtable \startxrow \startxcell hi \stopxcell \stopxrow \stopxtable \stopplacetable In Table \in[tab1] \stoptext It has [location=split], which I

[NTG-context] Background color of a framedtext that covers floats

=white] \startxrow \startxcell \bf Profondeur \m{x} (en mètre) \stopxcell \startxcell \bf Pression \m{P} (en bar) \stopxcell \startxcell \bf Volume \m{V} (en \m{\text{dm}^{3

Re: [NTG-context] splitted xtable with repeating headers and placetable

,height=max,] % frame=off,topframe=on,bottomframe=on some text in the middle block \stopframed \startframed[width=0.25\hsize,height=max] some text in the right block \stopframed \stopframed \stopframed \stopsetups

Re: [NTG-context] splitted xtable with repeating headers and placetable

split}] \setupxtable[ option=stretch,split=repeat,header=repeat,align=middle] \setupxtable[head][background=color,backgroundcolor=gray,foregroundcolor=red] \starttext Some lines of text. This text must come just before the table, but only on the first page of the table \def\onerow{ \startxrow \s

[NTG-context] splitted xtable with repeating headers and placetable

align=middle] \setupxtable[head][background=color, backgroundcolor=gray, topframe=on, bottomframe=on, framecolor=black, foregroundcolor=blue] \setupxtable[left][align=right] \starttext Some lines of text. This text must come just before the table, but only on the first page of the table \st

Re: [NTG-context] xtable headers and handlecsv loop

sv file. So in my second \doloopfromto I give >> the second argument a number high enough to be sure it reads all the >> lines. It works fine, but I would like to know if there is a way to >> read the number of lines in the csv file to use the exact number of >> lines, instead

Re: [NTG-context] xtable headers and handlecsv loop

of lines, instead of guessing. \usemodule[handlecsv] \opencsvfile{systaprov2.csv} \starttext \startbuffer[loop] \startxrow \startxcell[left] \cA \stopxcell \startxcell[left] \cB \stopxcell \startxcell[left] \cC \stopxcell \startxcell[left] \cD \stopxcell \startxcell \cE \stopxcell \startxcell[left]

[NTG-context] xtable headers and handlecsv loop

le{systaprov2.csv} \starttext \startbuffer[loop] \startxrow \startxcell[left] \cA \stopxcell \startxcell[left] \cB \stopxcell \startxcell[left] \cC \stopxcell \startxcell[left] \cD \stopxcell \startxcell \cE \stopxcell \startxcell[left] \cF \stopxcell \startxcell \cG \stopxcell \startxcell \

[NTG-context] Hatch color in a table cell

, backgroundcolor=white, framecolor=purple, meta:hash:linecolor=green] \startxrow \startxcell[background=color,backgroundcolor=paleturquoise] i \stopxcell \startxcell[background=meta:hash:right,frame=off

Re: [NTG-context] [HOWTO] spanning xtable cells

inbetween and/or columndistance > the cells of the xtable will not properly size when spanning over rows > and/or columns. > > e.g. > > \starttext > > \startxtable[spaceinbetween=2mm, columndistance=2mm, corner=round] > \startxtablebody > \startxrow >

Re: [NTG-context] [HOWTO] spanning xtable cells

On 1/31/20 12:13 AM, Floris van Manen wrote: > Does anyone knows a hint to get the stacked boxes to the correct size? > [...] > \startxtable[spaceinbetween=2mm, columndistance=2mm, corner=round] > \startxtablebody > \startxrow > \startxcell[ny=3] a1\stopxcell >

[NTG-context] [HOWTO] spanning xtable cells

, columndistance=2mm, corner=round] \startxtablebody \startxrow \startxcell[ny=3] a1\stopxcell \startxcell[nx=2] a2/3 \stopxcell \startxcell[ny=3] a4\stopxcell \stopxrow \startxrow \startxcell b2 \stopxcell \startxcell b3 \stopxcell \stopxrow

Re: [NTG-context] extreme table and right frames with vertically spanned cells

On 1/4/2020 7:00 PM, Damien Thiriet wrote: Hi list, It looks like switching off right frame is not taken into account when spanning cell vertically. Consider this example: \starttext \startxtable \startxrow \startxcell A \stopxcell \startxcell [ny=2,rightframe=off] B

Re: [NTG-context] extreme table and right frames with vertically spanned cells

\startxtable \startxrow \startxcell A \stopxcell \startxcell[ny=2, background=color, backgroundcolor=blue, rightframe=off, align=lohi, foregroundcolor=yellow] B \stopxcell \stopxrow \startxrow \

[NTG-context] extreme table and right frames with vertically spanned cells

Hi list, It looks like switching off right frame is not taken into account when spanning cell vertically. Consider this example: \starttext \startxtable \startxrow \startxcell A \stopxcell \startxcell [ny=2,rightframe=off] B \stopxcell \stopxrow \startxrow

Re: [NTG-context] wrong link /Rect in LMTX

ultiple line links. \setupinteraction [state=start] \enabledirectives[references.border=red] \starttext \startxtable[width=.25\textwidth, frame=on] \startxrow \startxcell\goto{\hyphenatedurl{abd.ab.ab.ab ab.ab.ab.ab.ab.ab.a.b}}[url(a)]\\ b\stopxcell \stopxr

Re: [NTG-context] wrong link /Rect in LMTX

On 12/6/2019 6:46 PM, Pablo Rodriguez wrote: Hans, \setupinteraction [state=start] \enabledirectives[references.border=red] \starttext \startxtable[option=stretch, frame=off] \startxrow \startxcell\goto{\hyphenatedurl{a}}[url(a)]\\ b\stopxcell

[NTG-context] wrong link /Rect in LMTX

Hans, \setupinteraction [state=start] \enabledirectives[references.border=red] \starttext \startxtable[option=stretch, frame=off] \startxrow \startxcell\goto{\hyphenatedurl{a}}[url(a)]\\ b\stopxcell \stopxrow \stopxtable \stoptext When compiled

Re: [NTG-context] issue splitting tables and horizontal mode

forgot to mention. \dontleavehmode is required to center the table when \startmakeup[standard][align=center]. You can use the float environment and disable the counter. \starttext \startplacefigure [location={none,split}]     \startxtable     \dorecurse{100}    {\startxrow

Re: [NTG-context] issue splitting tables and horizontal mode

Pablo Rodriguez schrieb am 18.10.2019 um 16:23: Dear list, I have another issue related to extreme tables. \setupxtable[split=yes] \starttext \startmakeup[standard] \dontleavehmode \startxtable[align={middle,lohi},columndistance=0em] \startxrow

  1   2   3   4   >